Published date: Sep 13 2022

Journal Title: KnE Life Sciences

Issue title: The 3rd International Conference on Advance & Scientific Innovation (ICASI) – Life Sciences Chapter

Pages: 481–488

DOI: 10.18502/kls.v0i0.11834

Ismoyowati .ismoyowati@unsoed.ac.idFaculty of Animal Science, Universitas Jenderal Soedirman, Purwokerto, Indonesia

S MugiyonoFaculty of Animal Science, Universitas Jenderal Soedirman, Purwokerto, Indonesia

E TugiyantiFaculty of Animal Science, Universitas Jenderal Soedirman, Purwokerto, Indonesia

IH SulistyawanFaculty of Animal Science, Universitas Jenderal Soedirman, Purwokerto, Indonesia

Rosidi .Faculty of Animal Science, Jenderal Soedirman University, Purwokerto, Central Java, Indonesia

The research was conducted to study the characteristics of growth, carcass production and growth hormone gene polymorphisms in various male sentul chickens. The research was conducted using experimental methods with a completely randomized design. The research material was 100 male day old chickens of Sentul. The treatment was a fixed factor, namely the variation of the color of the feathers of various Sentul chickens consisting of: “Abu” Sentul, “Emas” Sentul, “Geni” Sentul, “Debu” Sentul, “Batu” Sentul.. Each experimental unit consisted of 5 chickens and 4 replications. The variables measured included: hatching weight, body weight, body weight gain and the percentage of carcass produced at the age of 8 weeks. Identification of growth hormone gene polymorphisms used the primary design Gallus gallus haplotype GH-h22 growth hormone (GH) gene, complete cds, GenBank: JN675393.1 with forward primer / Sequence: AGGTGGTTCGGTTTTCACTG and reverse primer / Sequence: TCCCTTCTTCCAGGTCCTTT. Characteristics of growth and carcass production data were analyzed by analysis of variance; while to determine the presence of GH gene, polymorphisms were analyzed using the bioedit program. Analysis of variance showed that there were no significant differences (P> 0.05) between hatching weight, body weight, body weight gain and carcass percentage of various Sentul chickens. The results of GH Gallus gallus gene sequencing at base length 80 bp showed a mutation from adinine to cytosine, when comparing sentul chickens and Gallus gallus data in GenBank. The GH gene were present in various sentul chickens with monomorphic characteristics with homozygous genotypes of CC. The results of this study can be concluded that the characteristics of growth and carcass production in various Sentul chickens are relatively the same, as well as the monomorphic GH gene.

Keywords: Sentul chickens, body weight, carcass percentage, growth hormone gene, monomorphic.

[1] Nataamijaya AG. 2000. The native chicken of Indonesia. Buletin Plasma Nutfah 6(1):1−6.

[2] Zhou H, AD Mitchell, JP McMurtry, CM Ashwell and S Lamont. 2005. Insulin-Like Growth Factor-1 Gene Polymorphism Association with Chicken Body Composition, Skeleton Integrity and Metabolic Traits in Chickens. Poult Sci. 84:212-219.

[3] Li H, W Zhu, K Chen, X Wu, Q Tang and Y Gao. 2008. Associations between GHR and IGF-1 Gene Polymorphisms, and Reproductive Traits in Wenchang Chickens. Turk. J. Vet. Anim. Sci. 32:281-285.

[4] Anh NTL, S Kunhareang, M Duangjinda. (2015). Association of chicken growth hormones and insulin-like growth factor gene polymorphisms with growth performance and carcass traits in Thai broilers. Asian-Australasian journal of animal sciences. 28:1686.

[5] Pichner F. 1981. Population genetic and animal breeding. WH. Freeman and Co. San Fransisco.

[6] Nei M. 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics. 89:583-590.

[7] Sartika T, S Iskandar, LH Prasetyo, Takahashi and M Minezawa. 2004. Kekerabatan genetik ayam Kampung, Pelung, Sentul dan Kedu Hitam dengan menggunakan penanda DNA Mikrosatelit I: Grup pemetaan pada makro kromosom. J. Ilmu Ternak and Veteriner 9 (2):81-86.

[8] Rizzi C. 2018. Plumage colour in Padovana chicken breed: growth performance and carcass quality. Italian Journal of Animal Science 17 (3):797–803. doi.org/10.1080/1828051X.2017.1413598.

[9] Dewi GMAK, IM Nuriyasa and IW Wijana. 2017. Production of Chicken carcass and non carcass of kampung chicken who received rations skin Dragon fruit flour (Hylocereus polyrhizus) Fermented. In: Proc. The International Seminar on Tropical Animal Production. Contribution of Livestock production on food sovereignty in Tropical countries. September 12-14, 2017. Yogyakarta. Indonesia.

[10] Kazemi H, M Rezaei, H Hafezian, GR Mianji and M Najafi. Genetic Analysis of SNPs in GH, GHR, IGF-I and IGFBPII Genes and their Association with Some Productive and Reproductive Traits in Native Breeder Hens. Gene Technol 7 (1). 1-7. DOI: 10.4172/2329-6682.1000145

[11] Yulianty.2013. Keragaman Gen GH (Growth Hormone) Pada Populasi Kambing Kacang Di Kabupaten Jenoponto. Skripsi. Program Study Produksi Ternak Jurusan Produksi Ternak Fakultas Peternakan Universitas Hasanudin Makasar.

[12] Khaerunnisaa I, Jakaria, II Arief, C Budiman and C Sumantri. 2017. The Associations of GH and GHR Genes with Carcass Components in Indonesian Kampung and Broiler Chicken Cross. Media Peternakan. 40 (2):78-87. DOI: https://doi.org/10.5398/medpet.2017.40.2.78.

[13] Ge W, ME Davis, HC Hines and KM Irvin. 2000. Single nucleotide polymorphisma detected in exon 10 of the bovine growth hormone receptor gene. J. Anim. Sci. 78:2229-2230.

[14] Beauchemin, VR, MG Thomas, DE Frank and GA Silver. 2006. Evaluation of DNA polymorphisms involving growth hormone relative to growth and carcass characteristics in Brahman steers. Genet. Mol. Res. 5:438-447.

[15] Thomas MG, RM Enns, KL Shirley, MD Garcia, A.J Garrett and G.A Silver. 2007. Associations of DNA polymorphisms in growth hormone and its transcriptional regulators with growth and carcass traits in two populations of Brangus bulls. Genet. Mol. Res. 6:222-237.

[16] Sumantri, C, A Farajallah, and JF Salamena. 2010. Keragaman genetik DNA mikrosatelit dan hubungannya dengan performa bobot badan pada domba lokal. Media Peternakan. 31(1):1-13.